এই সাইটটি বার পঠিত
ভাটিয়ালি | টইপত্তর | বুলবুলভাজা | হরিদাস পাল | খেরোর খাতা | বই
  • টইপত্তর  আলোচনা   বিজ্ঞান ও প্রযুক্তি

  • আপনার গুরুচন্ডালির প্রবন্ধটি কি করে গাছে জমিয়ে রাখবেন 

    অরিন 
    আলোচনা | বিজ্ঞান ও প্রযুক্তি | ২৬ মে ২০২৪ | ২৮০ বার পঠিত | রেটিং ৫ (২ জন)
  • মনে করুন আপনার বা আপনাদের  গুরুর প্রবন্ধ আর এই আলোচনা  গুলো দিয়ে একটি মনোরম উদ্যান ​​​​​​​তৈরী ​​​​​​​হল, আমাদের লেখাগুলো সব জমার রইল বিভিন্ন গাছে গাছের পাতায়, লেখাগুলো ডিএনএ তে রূপান্তরিত হয়ে পাতায় পাতায় ​​​​​​​ছড়িয়ে ​​​​​​​গেল? 
    ব্যাপারটা ​​​​​​​কিরকম ​​​​​​​জানেন ?
    ধরুন এই কথাটা " আমি ​​​​​​​বাংলায় ​​​​​​​গান ​​​​​​​গাই " |
    কম্পিউটারে ​​​​​​​কথাটি লিখলে ​​​​​​​কথাটি ​​​​​​​বাইনারি ​​​​​​​কোডে রাখা ​​​​​​​রইল | সেটিকে DNA র ​​​​​​​ভাষায় A, T, G, C র কোডে লিখলে দেখতে ​​​​​​​লাগবে ​​​​​​​এইরকম "CAGCTAACAGGGGGCGAGGTCGGGGGTTTCGGGAGTTCCCGGGAAG" 
     
    নিজে ​​​​​​​হতে ​​​​​​​কলমে ​​​​​​​করতে ​​​​​​​চাইলে
    •  ​​​​প্রথমে chatgpt website https://chatgpt.com  খুলুন 
    • তারপর ​​​​​​​চ্যাট ​​​​​​​জিপি ​​​​​​​টি ​​​​​​​তে লিখুন " Convert the following text into DNA sequence by first converting the text into binary format based on ASCII, and then to DNA sequences by assigning 01 as A, 00 as C, 11 as G, and 10 as T: " 
    • লিখে ":" এর ​​​​​​​পাশে ​​​​​​​আপনার ​​​​​​​বাংলা ​​​​​​​লেখাটা ​​​​​​​লিখুন (যেমন আমার ​​​​​​​ক্ষেত্রে "আমি ​​​​​​​বাংলায় গান ​​​​​​​গাই " )
    • লিখলে ​​​​​​​চ্যাট ​​​​​​​জিপিটি আপনাকে ​​​​​​​লেখাটির ATGC কোডে বা ডি এন এ কোডে কি হবে জানিয়ে দেবে |
     
    এবারে এই যে DNA sequence বেরোল একে কম্পিউটার থেকে টেস্ট টিউবে সলুশনের modhye ডিএনএ পেতে গেলে আপনার  একটি DNA synthesiser  লাগবে | এ যন্ত্র  DNA synthesis করার যন্ত্র, অনেক রকমের ​​​​​​​হয়  ​​​​​​​এখানে ​​​​​​​একটা ​​​​​​​লিস্ট ​​​​​​​রাখা রইলো https://www.labx.com/product/dna-synthesizer ) | ব্যাপারটা কি জানতে ​​​​​​​ইচ্ছে হলে এখানে ​​​​​​​দেখুন https://sg.idtdna.com/pages/community/blog/post/dna-synthesis-the-basics
     
    সব আপনাকে হাতে কলমে করতেও হবে না , বিভিন্ন কোম্পানি আছে যারা আপনাকে করে দেবে |
    এই যে সিকোয়েন্সের সল্যুশন পেলেন একে আপনি একটি গাছে বা গাছের পাতায় ভরে দিন বা সেরকম হলে ব্যাকটেরিয়ার মাধ্যমে গাছকে ইনফেক্ট করুন , গাছ লাগান বাগান করুন জঙ্গল হোক আপনার ছবি আপনার লেখা থেকে |
     
    অবিশাস্য মেনে হচ্ছে ?
    একটি ফুলের দোকানের ভিডিও দেখাই ,
     
     
    Grow your own cloud ( https://growyourown.cloud ) দেখুন |
    একটা আলোচনা শুরু করা যাক |
     
    সহস্র পুষ্প বিকশিত হক , আক্ষরিক অর্থে ,:-)
     
     
     
     
  • মতামত দিন
  • বিষয়বস্তু*:
  • রমিত চট্টোপাধ্যায় | ২৬ মে ২০২৪ ১৩:০৩743064
  • এ এক অদ্ভুত জিনিসের খোঁজ দিলেন তো। বাঃ বিস্তারিত পড়ে দেখি।
  • অরিন | 2404:4404:1732:e000:642e:4ffa:e09d:5737 | ২৬ মে ২০২৪ ১৪:১৫743066
  • রমিত, 
     
    :-), আপনার এই এলোমেলো অরে জট ডাউন করা লেখাটা  পড়ে ইন্টারেস্টিং লেগেছে জেনে ভাল লাগল।‌ এটাকে আরেকটু গুছিয়ে লিখি বরং, স্টেপ বাই স্টেপ। 
     
    আমাদের চোখের সামনে গত তিন-চার দশকে ডাটা স্টোরেজ আর কমপিউটিং এ আমূল পরিবর্তন হয়েছে। ৯০ এর দশকে সবাই প্রায় "ফ্লপি ডিসক" (হাসবেন না, সত্যি ঐ নাম ছিল) ব্যবহার করত, একেকটায় মেরেকেটে ১.৪৪ মেগাবাইট ডাটা ভরা যেত। তার আগে যেটা ছিল, সে আর কহতব্য নয়, পাঞ্চ কার্ড দিয়ে অপেক্ষা করতে হত।  আমার নিজের কেনা প্রথম কম্পিউটারটা (সেটা একটা নোটবুক) তাতে শুধুই টারমিনাল ছিল, তার ওপর সেটাতে vi ছাড়া আর কিছু দিয়ে লেখা যেত না। vi যারা ব্যবহার করেছেন বা করেন, তারা জানেন সে কি জিনিস।
     
    Windows 3.1 যেদিন released হল, চারিদিকে শোরগোল। পরের কম্পিউটার যেটা কিনেছিলাম সেটাতে ১৬ মেগাবাইট (আজ্ঞে হ্যাঁ) RAM ছিল আর ১ জিবি hard drive space ছিল; -), তখন ফ্লপি ডিস্ক গিয়ে সিডির জমানা শুরু হয়েছে। তারপর ইউ এস বি ১,২,৩ কালক্রমে আসবে। এর মধ্যে কলকাতায় এক ওপেন সোর্স কনফারেন্সে RMS (Richard Stallman) সিংহগর্জন করে সবাইকে গুগলের ক্লাউড সার্ভার ব্যবহারের কুফল নিয়ে এক ঘণ্টাব্যাপী কীনোট দিয়েছিলেন। তারপর তো জিমেল এল, গুগল ডকস, আইফোন, আইপ্যাড, ম্যাকবুক এয়ার ... ডাটার জগতে "মেঘে যাকে বলে গাঙ্গেয় প্রপাতের যুগ এল"
    অতএব এর পর ব্যাকটেরিয়া, গাছ, পুষ্পে পত্রে বিকশিত ডাটার জগৎ ব্যাপ্ত হতে চলেছে।  
     
     
  • | ২৬ মে ২০২৪ ১৪:১৫743067
  • আরিসসাটা! এটা দারুণ ইন্টারেস্টিং ব্যপার তো! 
  • অরিন | 2404:4404:1732:e000:642e:4ffa:e09d:5737 | ২৬ মে ২০২৪ ১৪:২৩743068
  • :-)
  • অমিতাভ চক্রবর্ত্তী | ২৭ মে ২০২৪ ০১:২৯743073
  • ডাক্তারবাবু, এটা ঠিক যে এখন আমরা বিজ্ঞানের যে সব প্রয়োগ একেবারে হেলায় ফেলায় ব‍্যবহার করি, এক সময়, আর সেটা খুব বেশি দিন আগেও নয়, সেগুলো নিতান্তই কল্পনার বেশি কিছু ছিল না। তাই আমাদের সমস্ত তথ্য, সমস্ত লেখালেখি সহ, নির্ভুল ভাবে অথচ খুব কম জায়গায় জমিয়ে রাখার জন্য বীজ একটা চমৎকার ব‍্যবস্থা হতে পারে, এবং সেই তথ‍্যগুলি আবার বীজ থেকে অঙ্কুরিত গাছের মাধ্যমে একটু বা অনেকটা নতুন তথ‍্যে পাল্টে নেওয়া যেতে পারে, এ এখন নিতান্ত গিমিক বলে মনে হলেও, ভবিষ্যতে হয়ত একেবারে স্বাভাবিক কিছু হয়ে যেতেই পারে। 
  • অরিন | 202.36.179.109 | ২৭ মে ২০২৪ ০৩:২০743074
  • একেবারেই আমারও মনে হয়, এরকম কিছু হলে ভালই হয়। ব্যাপারটা যে শুধুই কল্পনা বা সাই-ফাই, তাও নয়। এখনই টেকসট, ইমেজ, ভিডিও স্টোর করে দিব্যি রিট্রিভও করা যাচ্ছে। 
  • অমিতাভ চক্রবর্ত্তী | ২৭ মে ২০২৪ ০৩:২৮743075
  • একেবারে এই সময়েই যেটা সম্ভব বলে মনে হয় - গুপ্তচর বৃত্তির কাজে এই বিদ‍্যাকে ব‍্যবহার করা। পাচার্য্য তথ্যকে বায়োলজিকাল মার্কার সহ গাছের জিনে ভরে দেওয়া হল। তারপর আরও একই রকম কিন্তু সাধারণ গাছের দলের সাথে  সেটিকে যথাস্থানে পাচার করে দেয়া হল। প্রাপক তার ল‍্যাবে গাছের পাতা কি ফুল ইত্যাদি বিশ্লেষণ করে সেই জেনেটিক কোড বার করে ডিকোড করে তথ‍্য হাতিয়ে নিল। কে জানে ইতিমধ্যেই চালু হয়ে গেছে কিনা!
  • মতামত দিন
  • বিষয়বস্তু*:
  • কি, কেন, ইত্যাদি
  • বাজার অর্থনীতির ধরাবাঁধা খাদ্য-খাদক সম্পর্কের বাইরে বেরিয়ে এসে এমন এক আস্তানা বানাব আমরা, যেখানে ক্রমশ: মুছে যাবে লেখক ও পাঠকের বিস্তীর্ণ ব্যবধান। পাঠকই লেখক হবে, মিডিয়ার জগতে থাকবেনা কোন ব্যকরণশিক্ষক, ক্লাসরুমে থাকবেনা মিডিয়ার মাস্টারমশাইয়ের জন্য কোন বিশেষ প্ল্যাটফর্ম। এসব আদৌ হবে কিনা, গুরুচণ্ডালি টিকবে কিনা, সে পরের কথা, কিন্তু দু পা ফেলে দেখতে দোষ কী? ... আরও ...
  • আমাদের কথা
  • আপনি কি কম্পিউটার স্যাভি? সারাদিন মেশিনের সামনে বসে থেকে আপনার ঘাড়ে পিঠে কি স্পন্ডেলাইটিস আর চোখে পুরু অ্যান্টিগ্লেয়ার হাইপাওয়ার চশমা? এন্টার মেরে মেরে ডান হাতের কড়ি আঙুলে কি কড়া পড়ে গেছে? আপনি কি অন্তর্জালের গোলকধাঁধায় পথ হারাইয়াছেন? সাইট থেকে সাইটান্তরে বাঁদরলাফ দিয়ে দিয়ে আপনি কি ক্লান্ত? বিরাট অঙ্কের টেলিফোন বিল কি জীবন থেকে সব সুখ কেড়ে নিচ্ছে? আপনার দুশ্‌চিন্তার দিন শেষ হল। ... আরও ...
  • বুলবুলভাজা
  • এ হল ক্ষমতাহীনের মিডিয়া। গাঁয়ে মানেনা আপনি মোড়ল যখন নিজের ঢাক নিজে পেটায়, তখন তাকেই বলে হরিদাস পালের বুলবুলভাজা। পড়তে থাকুন রোজরোজ। দু-পয়সা দিতে পারেন আপনিও, কারণ ক্ষমতাহীন মানেই অক্ষম নয়। বুলবুলভাজায় বাছাই করা সম্পাদিত লেখা প্রকাশিত হয়। এখানে লেখা দিতে হলে লেখাটি ইমেইল করুন, বা, গুরুচন্ডা৯ ব্লগ (হরিদাস পাল) বা অন্য কোথাও লেখা থাকলে সেই ওয়েব ঠিকানা পাঠান (ইমেইল ঠিকানা পাতার নীচে আছে), অনুমোদিত এবং সম্পাদিত হলে লেখা এখানে প্রকাশিত হবে। ... আরও ...
  • হরিদাস পালেরা
  • এটি একটি খোলা পাতা, যাকে আমরা ব্লগ বলে থাকি। গুরুচন্ডালির সম্পাদকমন্ডলীর হস্তক্ষেপ ছাড়াই, স্বীকৃত ব্যবহারকারীরা এখানে নিজের লেখা লিখতে পারেন। সেটি গুরুচন্ডালি সাইটে দেখা যাবে। খুলে ফেলুন আপনার নিজের বাংলা ব্লগ, হয়ে উঠুন একমেবাদ্বিতীয়ম হরিদাস পাল, এ সুযোগ পাবেন না আর, দেখে যান নিজের চোখে...... আরও ...
  • টইপত্তর
  • নতুন কোনো বই পড়ছেন? সদ্য দেখা কোনো সিনেমা নিয়ে আলোচনার জায়গা খুঁজছেন? নতুন কোনো অ্যালবাম কানে লেগে আছে এখনও? সবাইকে জানান। এখনই। ভালো লাগলে হাত খুলে প্রশংসা করুন। খারাপ লাগলে চুটিয়ে গাল দিন। জ্ঞানের কথা বলার হলে গুরুগম্ভীর প্রবন্ধ ফাঁদুন। হাসুন কাঁদুন তক্কো করুন। স্রেফ এই কারণেই এই সাইটে আছে আমাদের বিভাগ টইপত্তর। ... আরও ...
  • ভাটিয়া৯
  • যে যা খুশি লিখবেন৷ লিখবেন এবং পোস্ট করবেন৷ তৎক্ষণাৎ তা উঠে যাবে এই পাতায়৷ এখানে এডিটিং এর রক্তচক্ষু নেই, সেন্সরশিপের ঝামেলা নেই৷ এখানে কোনো ভান নেই, সাজিয়ে গুছিয়ে লেখা তৈরি করার কোনো ঝকমারি নেই৷ সাজানো বাগান নয়, আসুন তৈরি করি ফুল ফল ও বুনো আগাছায় ভরে থাকা এক নিজস্ব চারণভূমি৷ আসুন, গড়ে তুলি এক আড়ালহীন কমিউনিটি ... আরও ...
গুরুচণ্ডা৯-র সম্পাদিত বিভাগের যে কোনো লেখা অথবা লেখার অংশবিশেষ অন্যত্র প্রকাশ করার আগে গুরুচণ্ডা৯-র লিখিত অনুমতি নেওয়া আবশ্যক। অসম্পাদিত বিভাগের লেখা প্রকাশের সময় গুরুতে প্রকাশের উল্লেখ আমরা পারস্পরিক সৌজন্যের প্রকাশ হিসেবে অনুরোধ করি। যোগাযোগ করুন, লেখা পাঠান এই ঠিকানায় : [email protected]


মে ১৩, ২০১৪ থেকে সাইটটি বার পঠিত
পড়েই ক্ষান্ত দেবেন না। মন শক্ত করে প্রতিক্রিয়া দিন